DNA

Submit

Your name:
File:
Open code-statistics:

Language is selected by the extension of the file. See the list of supported languages to know the extension of your language.

Problem

select DNA decoding string

start codon:ATG
stop codon:TAA TAG TGA

Options

exec is denied

now post-mortem time, all source codes will be revealed

Sample input:_

ATGCCCTAA
GGGGGGGGGATGAAATTTGGGTAAGGGGGGGGGGGGGG
AAAAAAAAAAAAAAAAAAAAAAAAATAA
ATGAAAA

Sample output:

CCC
AAATTTGGG

AAA

Sample input:_

CCCCCCCCCATGATG
CCCCCCCCATGCCCCCCCCCCTGAAATAGGGGGTGA
TGACCCCCCATGCCCTAACC
ATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGACCCCCCCCCCCCCCCCCCCCCCCCTGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGAAA

Sample output:

ATG
CCCCCCCCCCTGAAA
CCC
ATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGACCCCCCCCCCCCCCCCCCCCCCCCTGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGAAA

Ranking

Ruby _

RankUserSizeTimeDateStatistics
1leonid420.03522011/11/18 20:26:580B / ?B / ?B
2yvl420.04422011/11/18 22:56:550B / 14B / 26B
3kaki390.03452011/11/27 04:41:350B / 12B / 25B

Perl _

RankUserSizeTimeDateStatistics
1tybalt89330.02962011/11/24 00:31:280B / ?B / ?B
2tails380.03542011/11/25 07:37:490B / 14B / 24B
3yibe390.03292011/11/20 03:38:190B / 17B / 20B

Scheme _

RankUserSizeTimeDateStatistics
1kaki620.15662011/11/25 16:19:380B / 28B / 34B
2kaki580.07732011/11/27 04:40:450B / 26B / 32B
3kaki(yvl)610.06252011/11/27 04:37:380B / 28B / 33B

JavaScript _

RankUserSizeTimeDateStatistics
1kaki680.03622011/11/25 16:21:520B / 30B / 38B
20mg(kaki)580.03722011/12/29 21:21:410B / 27B / 31B
3kaki640.03852011/11/27 04:40:320B / 28B / 36B
4kaki(yvl)670.03592011/11/27 04:38:260B / 30B / 37B

J _

RankUserSizeTimeDateStatistics
1I., S.530.23232011/11/20 17:52:110B / 19B / 34B
2I., S.(koyama41?)520.15082011/11/25 21:43:480B / 18B / 34B

C _

RankUserSizeTimeDateStatistics
1301900.02822011/11/23 05:42:5715B / 37B / 38B
2inaniwa900.02502011/11/23 09:38:250B / 53B / 37B
3inaniwa(embed)900.02712011/11/23 09:39:270B / 53B / 37B
4inaniwa(301)850.03082011/11/25 23:15:2315B / 33B / 37B

Haskell _

RankUserSizeTimeDateStatistics
1koyama411060.02692011/11/25 17:03:580B / 46B / 50B

sed _

RankUserSizeTimeDateStatistics
1tails350.02642011/11/24 03:32:360B / 10B / 20B
2:)370.02642011/11/24 20:23:250B / ?B / ?B
3clock380.02722011/11/20 13:29:090B / 15B / 20B
4:) (tails)330.03012011/11/26 02:26:030B / 10B / 21B

Bash _

RankUserSizeTimeDateStatistics
1mute1400.02982011/11/21 04:32:420B / 60B / 65B
2clock(tails)390.03132011/11/26 02:54:340B / 13B / 23B

wake _

RankUserSizeTimeDateStatistics
1clock660.03302011/11/22 00:53:370B / 16B / 46B
2clock(leonid)580.04372011/11/25 20:00:570B / 11B / 44B

GolfScript _

RankUserSizeTimeDateStatistics
1tails310.05772011/11/24 22:08:380B / 10B / 21B

Vim _

RankUserSizeTimeDateStatistics
1clock310.06602011/11/25 17:57:240B / 21B / 9B

Groovy _

RankUserSizeTimeDateStatistics
1nn802.12892011/11/27 13:17:490B / 46B / 34B

Language Ranking_

RankLangUserSizeScore
1GolfScripttails3110000
2Vimclock3110000
3Perltybalt89339393
4sed:) (tails)339393
5Bashclock(tails)397948
6Rubykaki397948
7JI., S.(koyama41?)525961
8wakeclock(leonid)585344
9Schemekaki585344
10JavaScript0mg(kaki)585344
11Groovynn803875
12Cinaniwa(301)853647
13Haskellkoyama411062924

return top