Local Alignment

Submit

Your name:
File:
Open code-statistics:

Language is selected by the extension of the file. See the list of supported languages to know the extension of your language.

Problem

Print out the results of local alignment. Inout/Output data format use "FASTA". However, the bigger font and 70 characters in FASTA lines.

see also:
* http://en.wikipedia.org/wiki/Sequence_alignment#Global_and_local_alignments
* http://en.wikipedia.org/wiki/Smith-Waterman_algorithm

Options

exec is denied

no deadline, the server will not save your submission

Sample input:_

>SEQUENCE_QUERY_1
ATCG
>SEQUENCE_QUERY_2
ATCG

Sample output:

>SEQUENCE_QUERY_1
ATCG
>SEQUENCE_QUERY_2
ATCG

Sample input:_

>SEQUENCE_QUERY_1
ACACACTA
>SEQUENCE_QUERY_2
AGCACACA

Sample output:

>SEQUENCE_QUERY_1
A-CACACTA
>SEQUENCE_QUERY_2
AGCACAC-A

Sample input:_

>SEQUENCE_QUERY_1
ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCATGGTGCTGTCTCCTGCCGACAAGACCAACGTC
AAGGCCGCCTGGGGTAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCC
>SEQUENCE_QUERY_2
ACTCTTCTGGTCCCCACAGACAAAGAGAGAACCCACCATGGTGCTGTCTCCTGCCGACAAGACCAACGTC
AAGGCCGCCTGGGGTAAGGTCGGCGCGAACACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTT

Sample output:

>SEQUENCE_QUERY_1
ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCATGGTGCTGTCTCCTGCCGACAAGACCAACGTC
AAGGCCGCCTGGGGTAAGGTCGGCGCG--CACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTT
CC
>SEQUENCE_QUERY_2
ACTCTTCTGGTCCCCACAGACAAAGAGAGAACCCACCATGGTGCTGTCTCCTGCCGACAAGACCAACGTC
AAGGCCGCCTGGGGTAAGGTCGGCGCGAACACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTT
--

Ranking

Python _

RankUserSizeTimeDateStatistics
1leonid1100.05052012/07/14 14:10:345B / 49B / 48B
2xulapp1300.19022011/02/19 11:32:370B / 53B / 72B
3hallvabo1390.09072010/11/27 08:53:400B / 80B / 55B

JavaScript _

RankUserSizeTimeDateStatistics
1xulapp1040.01832010/08/01 13:43:590B / 43B / 61B
2murky-satyr1080.00712010/04/17 14:42:070B / 52B / 56B
3nn1310.00382010/04/15 00:32:190B / 80B / 51B

SNOBOL _

RankUserSizeTimeDateStatistics
1clock1460.03552013/03/23 10:05:130B / 66B / 47B

Icon _

RankUserSizeTimeDateStatistics
1clock1380.06042012/05/06 03:54:530B / 64B / 70B

J _

RankUserSizeTimeDateStatistics
1I., S.(embed)820.08622011/12/02 12:21:180B / 37B / 36B

C _

RankUserSizeTimeDateStatistics
1yuyarin5060.02802010/10/24 01:04:340B / 241B / 262B

OCaml _

RankUserSizeTimeDateStatistics
1m.ukai (embed)3370.14162010/09/27 17:53:450B / 233B / 83B

Haskell _

RankUserSizeTimeDateStatistics
1rst761120.00262010/05/16 20:45:110B / 65B / 38B
2rst76(embed)1120.00252010/05/16 20:45:500B / 65B / 38B

Java _

RankUserSizeTimeDateStatistics
1hallvabo2540.42242010/09/17 23:27:350B / 171B / 75B

sed _

RankUserSizeTimeDateStatistics
1clock480.04932011/11/29 00:01:230B / ?B / ?B
2nn490.00262011/10/01 13:30:100B / 21B / 24B
3GeoJ520.02192010/10/23 12:55:160B / 19B / 28B

wake _

RankUserSizeTimeDateStatistics
1clock660.06512011/12/13 00:16:220B / 17B / 46B

GolfScript _

RankUserSizeTimeDateStatistics
1clock500.08482012/06/13 23:31:040B / 13B / 37B
2nooodl710.15282010/07/21 23:37:401B / ?B / ?B

gs2 _

RankUserSizeTimeDateStatistics
1whio300.30372017/04/28 23:45:3615B / 8B / 6B

z80 _

RankUserSizeTimeDateStatistics
1*yuko*480.50062010/10/24 19:38:2227B / 7B / 11B

Vim _

RankUserSizeTimeDateStatistics
1clock370.35642011/12/05 01:13:591B / 15B / 17B
2nn410.07362011/12/04 15:04:354B / 22B / 12B

Language Ranking_

RankLangUserSizeScore
1gs2whio3010000
2Vimclock378108
3z80*yuko*486250
4sedclock486250
5GolfScriptclock506000
6wakeclock664545
7JI., S.(embed)823658
8JavaScriptxulapp1042884
9Pythonleonid1102727
10Haskellrst761122678
11Iconclock1382173
12SNOBOLclock1462054
13Javahallvabo2541181
14OCamlm.ukai (embed)337890
15Cyuyarin506592

return top